Microsatellite based dna fingerprinting of 28 local rice oryza sativa. Application of dna based marker mutations for improvement. Based on previous reports 1011, we further simplified the process of dna extraction, and a protocol for rice dna isolation is reported here. A genomewide rice oryza sativa dna polymorphism database has been constructed in this work using the genomes of nipponbare, a cultivar of japonica, and 9311, a cultivar of indica.
Any genetic element locus, allele, dna sequence or chromosome feature which can be readily. Pdf dna fingerprinting of rice cultivars using aflp and. This database contains 1,703,176 single nucleotide polymorphisms snps and 479,406 insertion. Development of genomewide dna polymorphism database for.
Application of dna based marker mutations for improvement of. The coordinated research programme crp on the application of dna based marker mutations for improvement of cereals and other sexually reproduced crop plants. If we assume that this map covers the whole genome haploid 4. Pdf resistance genes and selection dna markers for blast.
Using minimum dna marker loci for accurate population classi. In this study, the eating quality of indica rice originating from indonesia was estimated by sensory test and physicochemical property assays. A nuclear rapd marker, opf182600, was linked to a thermosensitive genetic male sterility tgms gene tms3 in a rice mutant line ir32364tgms. Review dna marker technologies and their applications in. Links to the ssrit tool, the panel of 50 standard ssr markers used by the generation challenge program for rice diversity analysis, the table of ssr primers from mccouch et al. It can be used to reveal certain characteristics about the respective source. Microsatellite dna markers for rice chromosomes springerlink.
Segregation analysis in two mapping populations and. Routine stms analysis involving lowthroughput, laborious and timeconsuming. Dna polymorphism is the basis to develop molecular markers that are widely used in genetic mapping today. Materials and methods an indica rice cultivar, dgwg, and the source of blast resistance gene pi66t was used as the resistant control variety. In an attempt to develop dna markers associated with eating quality of indica rice, we used multiple regression analysis to test 54 markers, which were preselected for their possible association with eating quality, using 24 indica varieties with different palatability scores.
This experiment was conducted to evaluate genetic variation in 48 rice accessions oryza sativa l. Also the developed dna fingerprint of the selected elite rice. Additional information based on genetic mapping and nearest marker information provided the basis for locating a total of 1825 81% of the newly designed markers along rice chromosomes. Of these microsatellites, 35 out of 45 could be successfully converted into microsatellite dna markers using sequence information in their flanking regions. Rice, being a staple food crop for over onethird of the worlds population, has become a potential target for many dishonest traders and stakeholders for mixing with lowgrade, lowcost grainsproducts and poorly nutritious adulterants to make a profit with the least effort. David schneider, samuel cartinhour, doreen ware, lincoln stein, development and mapping of 2240 new ssr markers for rice oryza sativa l. Gene discovery and understanding the genetic mechanism for a trait are equally important in breeding for high yield and quality improvement. Singlenucleotide and insertiondeletion indel polymorphisms have been widely used as dna. In most applications, only one in a several million or billion cells will take up dna. These microsatellites were hypervariable and were easily to assay by pcr. Therefore, molecular markers in this article are mainly referred to as dna markers except specific definitions are given, although isozymes and protein markers are al. The development of dna based genetic markers has had a revolutionary impact on animal genetics. Therefore, dna extraction has become a bottleneck for largescale applications of dna markers and transgenic detection 9. Marker development for rice blast resistance gene pi66t.
Pdf dramatic changes in climatic conditions that supplement the biotic and abiotic stresses pose severe threat to the sustainable rice. Molecular marker based genetic diversity analysis mmgda is capable of assessing changes in. Lobos, karen clare,3 mark wal ton,3 binying fu, 4reycel maghirang,4 zhikang li, yongzhong xing,5 qifa zhang,5 izumi kono,6 masahiro yano,7 robert fjellstrom,8 genevieve declerck,9 david. Dna markers for testing distinctness of rice oryza sativa l. Improving rice yield and quality through conventional. Sequence tagged microsatellite site stms are useful pcr based dna markers. Development of genomewide dna polymorphism database for map. The use of dna markers in breeding for improved california. The use of resistant varieties is considered one of the most efficient ways of crop protection from the disease.
This database contains 1,703,176 single nucleotide polymorphisms snps. We prevent an ultrasimple dna extraction method for microsatellite analysis of rice. Analysis of population structure and genetic diversity. This gene confers resistance to many forms of the blast fungus, so these markers are quite valuable for selecting and breeding diseaseresistant rice cultivars. We found 369 complete microsatellites, of which cgggccn was the most frequent, in 11 798 rice sequences in the database. Assessment of genetic purity in rice oryza sativa l. Ultrasimple dna extraction method for markerassisted.
Pdf blast is a serious disease caused by a fungal pathogen pyricularia oryzae cavara of rice oryza sativa l. Dna fingerprinting of rice australian journal of crop. The advances in rice genomics created opportunities for the application of dna markers in breeding and genetics. A highdensity rice genetic linkage map with 2275 markers. Fingerprinting and variety identification of rice oryza. Snps are the most plentiful type of markers in rice or in any other genomes begum et al. Dna research 9, 199207 2002 development and mapping of 2240 new ssr markers for rice oryza sativa l. A simplified rice dna extraction protocol for pcr analysis. Popular genetic markers in the aquaculture community include allozymes, mitochondrial dna, rflp, rapd, aflp, microsatellite, snp, and est. The statistical analysis has been used to measure the mutual relationships between various characters and yield improvement. Ydna str markers change mutate often enough that most men who share the same str results also share a. A set of 192 diverse rice germplasm lines were genotyped using 61 genome wide ssr markers to assess the molecular genetic diversity and genetic relatedness.
Sep 26, 2015 a set of 192 diverse rice germplasm lines were genotyped using 61 genome wide ssr markers to assess the molecular genetic diversity and genetic relatedness. For aflp, a total of 928 bands were generated with 11 primer. The genetic diversity of 175 rice accessions from myanmar, including landraces and improved types from upland and lowland ecosystems in five different areaswestern hilly, northern mountainous, north and southeastern plateau, and southern plainwas evaluated on the basis of polymorphism data for 65 dna markers and phenol reactions. Thus, the time and labor used to develop new microsatellite dna markers. Because the resistance genes are natural, their use represents an environmentally friendly way to combat the disease. Rice blast disease caused by magnaporthe oryzae is one of the most destructive disease causing huge losses to rice yield in different parts of the world. The map provides the most detailed and informative genetic map of any plant. A rumuganathan and e arle 1991, then the markers are located every 190 kb on. A gelless approach for detection of stms markers in. The genetic diversity of rice from different subspecies and dna markers for eq can effectively be utilized for basic information and markerassisted selection mas for the development of improved. The ssr markers can be effectively applied for developing unique dna profiles of rice genotypes because of having a high level of polymorphism and greater information. Diversity of some indonesia local glutinous rice oryza l. Current status and prospects article pdf available in journal of integrative agriculture 2017160. Evaluation of genetic diversity in rice subspecies.
These mark ers are also used as dna markers to find the population substructure jain et al. Genetic diversity of aromatic rice germplasm revealed by ssr. Several types of molecular markers are available for diversity within the two rice subspecies indica and japonica. The use of dna markers in breeding for improved california rice varieties introduction the rice experiment station res uses traditionally the pedigree breeding method in rice cultivar improvement. The 8 rice hybrids and their parental lines were analyzed using 51 ricespecific microsatellite markers for fingerprinting and to identify genetic impurities in the seed lot of cms lines, restorers and hybrids. Development and mapping of 2240 new ssr markers for rice oryza sativa l. Genetic markers are closely related with the target gene and they act as sign or. New molecular markers associated with the eating quality of indica rice were then identified and compiled with previously reported markers to be used for a genotyping test. Dna sequence with a known chromosome location controlling a particular gene or trait. Genetic diversity of aromatic rice germplasm revealed by. Microsatellite combines several features of an ultimate molecular marker and.
Genetic diversity has been utilized and preserved partially during the process of domestication and cultivation and not even 15 percent of potential genetic diversity has been utilized in crop plants. Restriction fragment length polymorphism rflp, random amplified polymorphic dna rapd, simple sequence repeats ssrs, amplified fragment length polymorphism aflp and single nucleotide polymorphisms snps 11, 12. A total of 98 alleles were obtained using 51 markers with an average of 1. Dna based molecular markers like ssr and rapd have proven to be very useful in dus testing of closely related rice varieties santhy et al. Genetic diversity analysis of traditional rice variety.
Top 10 types of dna markers genetics biology discussion. Identification of iraqi rice varieties using dna markers. Each extraction requires only one microtube, one disposable pipette tip, te buffer and few pieces about 5 mm of rice leaf tissue. Rice family ydna project ydna classic chart for genealogy within the most recent fifteen generations, str markers help define paternal lineages. Discover your dna story and unlock the secrets of your ancestry and genealogy with our dna kits for ancestry and the worlds most comprehensive dna database. We report here the terminal sequencing of 354 dna markers of the cornellirri genetic map of rice and the conversion of 100 of them into stss by synthesis of pairs of pcr primers. Blast is a serious disease caused by a fungal pathogen pyricularia oryzae cavara of rice oryza sativa l. Assessment of the genetic diversity of rice germplasms. Dna, for example, is a molecular marker containing information about genetic disorders, genealogy and the evolutionary history of life. Dna markers are also called molecular markers in many cases and play a major role in mo.
With dna markers, it is theoretically possible to observe and exploit genetic variation in the entire genome. Recently, dna markers had augmented the breeding efforts in breeding rice for the different grain and market types. Crunching new data on walnut genes new dna markers for. Development and mapping of 2240 new ssr markers for rice oryza. The genetic diversity of rice from different subspecies and dna markers for eq can effectively be utilized for basic information and markerassisted selection mas for the. Y dna str markers change mutate often enough that most men who share the same str results also share a recent paternal lineage. We have mapped a total of 2275 markers with 1174 discrete positions on the rice genome, covering 1521. Integration of these markers with the published microsatellite dna markers showed that about 35% of the rice chromosomes were covered by the 56 microsatellite dna markers. Pdf dna markers for eating quality of indica rice in indonesia. Dna markers for eating quality of indica rice in indonesia puji lestari 1,2,wenzhujiang 3,sangho chu 1,4,reflinur 2,sutrisno 2,bram kusbiantoro 5, backki kim 1,rihuapiao 1,youngchan cho 6,zhixiang luo 7,joonghyeonchin 4 and heejong koh 1,8 1department of plant science and research institute for agriculture and life sciences, plant. The extract can be kept in the freezer for longterm storage. Therefore, an attempt has been made to find out the resistance by screening and studying the genetic diversity of eighty released rice varieties by national rice research institute, cuttack nrvs using molecular markers linked to. Pdf sequencetagged sites and lowcost dna markers for rice. Using minimum dna marker loci for accurate population.
Crunching new data on walnut genes new dna markers for rice. Thus, the time and labor used to develop new microsatellite dna markers could be saved by using these published. The result of genetic diversity analysis on 299 varieties of indica inbred rice with intron length polymorphism ilp and ssr markers indicated a low level of genetic diversity ming et al. Also, in this study, we developed a core marker set for the identification of rice varieties using ssr markers and constructed a dna profile. Mcclung usdaarsrice research unit beaumont, texas rice quality traits aroma cooked kernel elongation apparent amylose content pasting properties. It takes approximately 14 yr to produce a new rice oryza sativa l. Eight groups of closely related rice cultivars were firstly identified based on the fingerprinting data. Genetic markers are broadly grouped into two categories. Direct amplification of minisatellite dna markers damdpcr. We will be developing new and more effective markers for predicting rice quality. These dna markers are linked to the piz blastresistance gene in rice. Dna markers are used for molecular characterization. In addition, ssr markers were also used to distinguish the rice varieties from each other. Because of the high level of polymorphism, and therefore the greater informativeness of microsatellite markers, it seemed likely that these markers would be particularly useful for developing unique dna profiles of rice genotypes.
Primer code p rim er sequence 5 to 3 rm 21 f acagtattccgtaggcacgg r gctccatgagggtggtagag rm 216 f gcatggccgatggtaaag. Lobos, karen clare,3 mark wal ton,3 binying fu, 4reycel maghirang,4 zhikang li, yongzhong xing,5 qifa zhang,5. Rice family y dna project y dna classic chart for genealogy within the most recent fifteen generations, str markers help define paternal lineages. Routine stms analysis involving lowthroughput, laborious and timeconsuming polyacrylamideagarose gels. Mcclung usdaars rice research unit beaumont, texas rice quality traits aroma cooked kernel elongation apparent amylose content pasting properties gelatinization temperature. Development and mapping of 2240 new ssr markers for rice. The development of dnabased genetic markers has had a revolutionary impact on animal genetics. Feb 08, 2016 the 8 rice hybrids and their parental lines were analyzed using 51 rice specific microsatellite markers for fingerprinting and to identify genetic impurities in the seed lot of cms lines, restorers and hybrids. Also, dna can be extracted from 200300 individuals in a few hours. Pdf dna markers for eating quality of indica rice in. Molecular markers and markerassisted breeding in plants. Genotyping of 192 rice lines using 61 ssrs produced a total of 205 alleles with the pic value of 0. A molecular marker is a molecule contained within a sample taken from an organism biological markers or other matter. Genetic diversity, identification, and certification of chilean rice.